Contexo Home Page ] Introduction ] Basic Chemistry ] Cell Chemistry ] Cell Structure ] Mitochondria ] Cell Nucleus ] Chromosomes ] Mitosis ] Meiosis ] Proteins ] DNA ] DNA Replication ] Gene Expression ] Mutation ] Molecular Genealogy ] Collecting Your Own DNA ] Polymerase Chain Reation ] [ Primers ] DNA Sequencing ] How Microsatellite Repeats Are Counted ] YSTR Database Allele Frequency Charts ] Dorsey DNA Surname Project Home Page ] Links ]

Search this site:

Search for

 Contexo.Info 

 I Weave Together Information

 What are Primers?    

 And Why Do We care?


Through some quirk of evolution, DNA polymerase is only able to add nucleotides to the 3' (sugar) end of a growing chain of DNA.  Therefore, it is not able just to start right up building a complementary strand for a length of DNA that has been separated from its partner.  To get around this problem in the cell, an enzyme called a primase produces a short string of nucleotides (usually 15-30) that are complementary to the first part of the segment of DNA that is being copied.  This string of nucleotides, called a  primer , attaches to the beginning of the template strand by base pairing.  DNA polymerase is then able to add the next complementary nucleotide to the free 3' end of the primer.  From there it continues adding more complementary nucleotides to the template DNA until a new double strand of DNA is completed. (See DNA Replication for more detail.)

The sides of a DNA molecule are antiparallel, that is, they run in opposite directions.  In other words, the sugar molecule of one base pair compared to the other is flipped over--so that the two sides of a DNA chain are replicated from different directions.  Since DNA polymerase operates from the 5' (phosphate) to the 3' (sugar) end, this means that two different DNA primers are needed--one for each  5' end of side of the molecule.

It is this requirement for dual primers that makes it possible to precisely define the area of a DNA molecule to be amplified by the PCR.  By using custom made primers with complementary sequences at, or adjacent to, the beginning of the marker targeted for amplification, it is possible to specify where the new chain should begin.

Of course, it is also necessary to tell the DNA polymerase where to stop as well as where to begin.  A second primer with sequences that are complementary to the end of the targeted segment is added to the PCR brew.  In this way it is possible to  create short segments of "target DNA" that include only the marker of interest and  a bit of its flanking region on either end.  Below is a diagram of the first few steps of this reaction showing how these primers accomplish this.  The marker in this example is based loosely on the Y STR marker DYS391 and its published primers (http://www.cstl.nist.gov/biotech/strbase/str_y391.htm.)   Modifications have been made for brevity and clarity.  There are eight repeats of the tetranucleotide sequence CTAT.

The marker (DNA segment) targeted for amplification is highlighted in yellow. 

1


   5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'
    3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'
 

  • Primers to match the ends of the target are show below--the left primer is highlighted in green and the right primer highlighted in blue. 

  • Right and left arrows signify that the DNA strand extends indefinitely in the direction of the arrow though sequences are omitted to conserve space.

  • Sequences in green represent the two strands of the original DNA being amplified.  Sequences in red represent strands synthesized during the PCR

  • Each round of the PCR is a three step process controlled by precise temperature changes.

    1. As the temperature is raised to 94-96° Centigrade, the two strands of DNA separate.

    2. When the temperature is lowered to 50-65° Centigrade, the primers find their complementary sequences adjacent to the target DNA segment and anneal to them (bind.)

    3. As the temperature is raised to 72° Centigrade, DNA polymerase begins adding nucleotides from the PCR mixture to both strands (see DNA Replication for more details.)


1

2

 

       5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'    
               
3'-CTATTCATTCAATCATACACCCAA


      
  CTAAGAAACACCACCCAGAC-3'            

       3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'
 

 

In the first round (below), there are two double stranded DNA strnds.  However, there is nothing in this place to tell the enzyme where to stop on either strand both strands extend well beyond the target segment at the 3' end.  However, one end of each newly synthesized strand has been defined by the positions of the primers--the  leading strand will begin at the 5' end of the target (primer highlighted in green above.)  The  lagging strand (primer highlighted in blue above) will begin at the 3' end. The original template strands  retain their length (signified by the green arrows.)

1


2

        5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'
                
3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'                                          
         5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'          
         3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5' 

Results of Round One             

After round two (below), two of the resulting four double stranded molecules each has one strand that contains only the marker and its flanking regions and one strand that has one end defined and the other still extended.  The other two strands are each made up of one strand of the original molecule and one strand that extends beyond the marker at one end and is "cut" at the other.

1

2

3

4

 

       5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'       
               3'-CTATTCATTCAATCATACACCCAA
GATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'
                                                           
                                        
                                                       
               5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTAT
CTAAGAAACACCACCCAGAC-3'  
               3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'


       
5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'          
               3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5   
       
      
5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'            
       3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'

Results of Round Two        

At the end of round three (below,) PCR finally yields two double stranded molecules of the desired length (numbers 3 and 6) and an assortment of others. 

1

2

3

4

5

6

7

8

 

        5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'                         3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'                                                                                                           
                                                      
                5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTAT
CTAAGAAACACCACCCAGAC-3'
                3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'

                5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'
                3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'

                5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'           
                3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5' 

        5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'                                3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'              
                                                           
                                        
                                                      
                5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTAT
CTAAGAAACACCACCCAGAC-3'     
                3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'     

        5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'    
       
         3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'    

        5'-GATAAGTAAGTTAGTATGTGGGTTCTATCTATCTATCTATCTATCTATCTATCTATCTAAGAAACACCACCCAGAC-3'              
        3'-CTATTCATTCAATCATACACCCAAGATAGATAGATAGATAGATAGATAGATAGATAGATTCTTTGTGGTGGGTCTG-5'    

Results of Round Three

As the cycles continue, more and more of segments that include only the marker and the bits of flanking nucleotides are generated.  While the original strands do continue to generate "uncut" or "half-cut" molecules, their concentration is negligible.  At the end of 30 cycles, 1,073,741,764 copies of the desired length have been produced but only about 60 of the "uncut" variety.

And, after plowing through all of this, probably the best way to understand the way primers can be used to isolate targeted sections of DNA for amplification in PCR is to view the flash animation from the Dolan DNA Learning Center at Cold Springs Harbor. http://www.dnalc.org/shockwave/pcranwhole.html

It is the sequence of this  primer that determines where it binds to the DNA sample and thereby defines the region of DNA to be amplified. This small strand of nucleotides anneals (binds) by complementary base pairing to the beginning of the area being copied.  With the primer in place, DNA polymerase is then able to continue adding the rest of the pairs of the segment    (Adding an excess of primers insures that the primers will bind to the separated strands of the DNA samples so that the separated strands don't just recombine (self-anneal) when the temperature is lowered.)  

By carefully choosing the proper primers, it is possible to specify exact regions of a DNA mixture for amplification.  So rather than making copies of the entire mix of DNA in a sample, it is possible to copy only certain segments which can then be analyzed, measured and compared.   The PCR process uses primers that have been synthesized in the laboratory to bind to highly specific sites on DNA. The DNA between the primers is replicated with great fidelity using a DNA polymerase enzyme

There are a number of interactive websites and software programs that aid in designing primers for replicating specific predefined regions of DNA such as the markers on the Y chromosome used for genealogical testing.  At present, the application of this science to genealogical research is very new--with only a handful of labs even offering such services.   It is not clear whether all labs are using the same primers for each marker.  For this reason marker values of tests conducted by different labs may not be 100% comparable.  

For a more detailed discussion of primer selection see:  http://www.vmresearch.org/genotype/primers.htm 

 

Hit Counter

Where Can I Go From Here?? 

Contexo Home Page ] Introduction ] Basic Chemistry ] Cell Chemistry ] Cell Structure ] Mitochondria ] Cell Nucleus ] Chromosomes ] Mitosis ] Meiosis ] Proteins ] DNA ] DNA Replication ] Gene Expression ] Mutation ] Molecular Genealogy ] Collecting Your Own DNA ] Polymerase Chain Reation ] [ Primers ] DNA Sequencing ] How Microsatellite Repeats Are Counted ] YSTR Database Allele Frequency Charts ] Dorsey DNA Surname Project Home Page ] Links ]

This web is lovingly dedicated to the memory of
Mr. James Dorsey
who so graciously and enthusiastically
donated his DNA to solve our family mystery. 


Jim Dorsey
2/12/1930 — 4-30-2002

 ©Copyright  Contexo.info 2002-2004
Not for profit, educational website