Mutation

A mutation is a change in genetic information. Since genetic information is encoded by the order of the nucleotide bases of DNA, adenine (A), thymine (T), guanine (G), and cytosine (C), a mutation represents some sort of change in that order. Mutations may occur in both somatic and sex cells. Only mutations that occur in sex cells can be passed from parent to offspring.

Point Mutations or SNPs

A point mutation or SNP (Single Nucleotide Polymorphism) involves the substitution of a wrong base during the replication process. As the enzyme DNA polymerase chugs down one side of a DNA molecule, forming base pairs to build a new complementary strand, it occasionally adds the wrong base. Below is a small portion of the genetic code for the protein hemoglobin. The top row is the normal sequence for making normal hemoglobin. The bottom row shows a single nucleotide polymorphism—a change from A to T—that results in a mutated form of hemoglobin that results in the sickle cell anemia disorder.

GTGCATCTGACTCCTGAGGAGAAGTCT
GTGCATCTGACTCCTGTGGAGAAGTCT

Fortunately, DNA polymerase makes very few errors and it corrects most of those quickly. In addition, there are other enzymes that follow along and "proofread" the nucleotides to be certain that the new nucleotides are actually complementary to the template strand. Any misfits are booted out and replaced with the proper base. Thanks to this magnificent system, DNA is consistently replicated with less than one mistake per billion nucleotides.


Nonetheless, this type of mutation does occur. It is rare but it is responsible for many subtle and not so subtle variations found within and among species.

There are three possible outcomes of a mistaken change of one nucleotide during DNA replication during the formation of a sex cell. Surprisingly, the "mistake" may have no effect on the organism. For one thing, the genetic code is such that many amino acids are represented by more than one codon (see also Gene Expression).

Each individual codon is a three nucleotide sequence. In many instances, there are several sequences that code for the same amino acid. Their sequence frequently differs by only one nucleotide.

23andme (18 April 2010) Genetics 101: What are SNPs? [Video file] retrieved from https://youtu.be/tJjXpiWKMyA

For example, the triplet codons for the amino acid isoleucine are AUU, AUC, AUA, and AUG. Substitution of the the last nucleotide in the DNA sequence coding for this amino acid would result in no change in the resulting protein because isoleucine would be inserted in the protein chain in each case. Similarly, if the substitution affects a less critical region of the protein or occurs in a noncoding region of DNA, there may be no discernible effect at all.

On the other hand, an error which changes the first base of the codon to either a U, C, or G would cause the wrong amino acid to be inserted in place of isoleucine. For example, a substitution of a G for the first A in the codon would result in insertion of the amino acid valine instead of isoleucine.

The insertion of the wrong amino acid in a functional region of a protein may cause the protein to be so severely misshapen that it cannot function--even to the point of causing the death of the organism. The function of normal human red blood cells, which are disk-shaped, is to transport oxygen from the lungs to the other organs of the body.  Each red blood cell contains millions of molecules of hemoglobin that carries oxygen. A slight change in the order of the amino acids in the hemoglobin molecule (valine substituted for glutamine), which has only 146 amino acids, causes sickle-cell disease.  Abnormal hemoglobin molecules stick together and crystallize deforming the red blood cells.  The deformed blood cells then clog tiny blood vessels impeding the flow of blood.  Sickle-cell anemia kills about 100,000 people per year in the US.

Chart of sickle cell anemia mutation

And finally, there are the rare substitutions that are actually beneficial causing the protein to function in such a way as to give the organism a survival advantage.

SNPs are the type of mutations reported in autosomal, and some kinds of Y chromosome DNA testing for genealogy.

SNPs are so infrequent that it is reasonable to assume they have occurred at any particular position in the genome only once in the course of human evolution

Where Can I Go From Here?

Contexo.info is a not for profit, educational website.

©️2002 - 2017 Context.info

Where Can I Go From Here?

©️2002 - 2017 Context.info

Contexo.info is a not for profit, educational website.