Y Chromosome Testing for Genealogy

FutureLearn (17 May 2016) How Is the Y Chromosome Passed Down by Males Through the Generations? [Video file] retrieved from https://youtu.be/vC92N5lndjE

Please consider a donation on behalf of Family Tree DNA staff whose homes have been damaged or destroyed in the flooding caused by Hurricane Harvey. Family Tree DNA is the pioneer and leader in genetic genealogy and currently the only company offering Y chromosome testing for genealogy. FTDNA has committed to matching all donations made via the YOUCARING link above. More about the fundraising effort at https://www.youcaring.com/familytreednaemployeehomesfloodedbyhurricaneharvey-929617

A Review of DNA Basics


DNA is a long, double chain of subunits called nucleotides or bases. In spite of the size and complexity of a DNA molecule, there are only four different bases, each referred to by its first letter: adenine (A), guanine (G), cytosine (C) and thymine (T). As the two chains line up next to each other to make a DNA molecule, adenine (A) and thymine (T) pair only with each other as do guanine (G) and cytosine (C). A DNA molecule is characterized by the sequence of these base pairs (bps) along the chain. Click here for more detail about DNA structure.

While whole genome sequencing is becoming more readily available, it is still too expensive and too time consuming to be a practical tool for the genealogist. Instead scientists have looked for sets of nucleotide pairs or sequences of pairs that are highly polymorphic--that is, sections of DNA where a variety of different sequences (called alleles) are found among individuals in the same human population. These sets are referred to as markers.

Short Tandem Repeats (STRs)


Only about five percent of human DNA is actually thought to code for traits. Most of the rest is made of long stretches of nucleotide base pairs whose function is not known. Within these stretches are short, moderately repetitive base pair sequences. The number of repeats is inherited and is easily detectable making them ideal identifying markers. The number of repeating units can occasionally change during evolution and descent. Though these changes are rare, they happen frequently enough to make them useful markers for familial relationships.

A Common Misconception


is that DNA testing can only reveal a person's father's or paternal line. This is not correct.


That misconception is rooted in the correct fact that Y DNA (or Y chromosome) testing is only available to males and only reveals the direct paternal line .

Because women do not have a Y chromosome, they cannot participate in Y DNA testing directly. However, women who want to learn about their direct paternal line can recruit a father brother, uncle or cousin—even a distant cousin—to test on her behalf. (Be sure to offer to pay for the test if your surrogate candidate is not mad for genealogy.)

Women (and men) can also use
mitochondrial DNA testing to learn a bit about their direct maternal line.

In more recent years, autosomal DNA testing has become available to all. Autosomal DNA testing can be used to learn about maternal and paternal lines by both males and females. It has become a major tool for the genealogy community.

One type of these repetitive markers are called Short Tandem Repeat (STR) or sometimes microsattelites. The units of STRs are much generally from two to ten base pairs in length and may be repeated as many as 100 times at a given location on a chromosome. The human genome contains hundreds of thousands of these STRs evenly distributed on all the chromosomes. STRs make ideal markers for genetic typing for genealogy because of their rich diversity (polymorphism) and wide distribution. They can be characterized quickly and fairly easy in the lab.

Here is a simplified example. Humans have two sets of 23 chromosomes--one set from their mother and one set from their father. So, for example, an individual, Thelma, might inherit a chromosome #17 marker with a short sequence of four bps repeated eight times from her mother, Ethel, and the same sequence repeated three times from her father, Art.

To illustrate :
Maternal chromosome #17 GATCGATCGATCGATCGATCGATCGATCGATC
Paternal chromosome #17 GATCGATCGATC

Where Can I Go From Here?

©️2002 - 2017 Context.info

Contexo.info is a not for profit, educational website.

Where Can I Go From Here?

©️2002 - 2017 Context.info

Contexo.info is a not for profit, educational website.