|
|
|
In a broader scope, a growing number of surname studies are being conducted to ascertain whether families with the same surname are of common or independent origin. Combining the results of these studies with traditional genealogical information, researchers hope to hone in on geographical areas from which their families may have arisen--thereby giving themselves new areas in which to explore traditional resources. Characterizing an Individual's DNA DNA is a long, double chain of subunits called nucleotides or bases. In spite of its size and complexity, there are only four different bases, each referred to by its first letter: adenine (A), guanine (G), cytosine (C) and thymine (T). As the two chains line up next to each other to make a DNA molecule, adenine (A) and thymine (T) pair only with each other as do guanine (G) and cytosine (C). A DNA molecule is characterized by the sequence of these base pairs (bps) along the chain. (Amazingly, it is this sequence that codes for all of an organism's traits.) Mutations and the shuffle of maternal and paternal genes through sexual reproduction, ensure that each member of a species (except identical twins) has a unique DNA sequence. The ideal way to distinguish an individual from all the other people on Earth would be to describe the entire sequence of nucleotides in his or her DNA. However, since each human genome (all the DNA in a person's chromosomes) is made up of more than 3 billion nucleotide bps, describing an individual's complete DNA would be far to complicated and expensive to be practical! Instead, scientists have looked for sets of nucleotide sequences that are highly polymorphic--that is, sections of DNA where a variety of different sequences (called alleles) are found among individuals in the same human population. These sets are referred to as markers and are usually given names which often seem quite arbitrary (read senseless) to the layperson but which usually reflect some esoteric coding of scientific data from the lab which has defined it. Only about five percent of human DNA is actually thought to code for traits. Most of the rest is made of long, apparently nonfunctional, stretches of nucleotide bps (sometimes referred to a "junk" dna.) Within these nonfunctional stretches are short, moderately repetitive base pair sequences. The number of repeats is inherited and is easily detectable making them ideal identifying markers. The number of repeating units can occasionally change during evolution and descent. They are thus useful markers for familial relationships and have been used in paternity testing, forensic science and in the identification of human remains. There are two types of these repetitive sequences. VNTRs (variable number tandem repeats) are repeated sequences that typically range from 10 to 80 bps. These occur fairly frequently in the human genome but there are relatively few different types.
Short tandem repeat (STR) sequences
(sometimes called microsatellites) are much
shorter (2-10 bps) and may be repeated as many as 100 times at a given
location on a chromosome. The human genome contains hundreds of
thousands of these STRs all evenly distributed on all the chromosomes.
STRs represent ideal markers for genetic typing because of their rich
diversity, wide distribution, and polymorphism. As a further
advantage, they are technically somewhat easier to characterize than VNTRs.
To illustrate : Maternal
chromosome #17 GATCGATCGATCGATCGATCGATCGATCGATC In real life, more than one STR must be analyzed to establish a person's identity. A marker on DNA from a hair found at the scene of a crime may match one marker of a suspect. However there will most likely be thousands of unrelated people with the same pattern for that one marker. Increasing the number of markers examined increases the chances of an accurate identification. Matches in three selected STRs gives more than a 2000 to 1 probability that the DNA samples are from the same person. Using nine STRs gives more than a 1 billion to 1 probability. In 1997, the FBI announced the selection of 13 STR markers to be used in forensic investigations. If any two samples of DNA obtained from different sources (say a crime scene and a suspect) have matching numbers of repeats at all 13 markers, it is virtually certain they are from the same person. Conversely, and as important, if the markers do not match, it can be said with complete confidence that the samples are from two different individuals. DNA Testing for Genealogy Differs From DNA Testing to Identify an Individual
As the
number of repeats of these markers are inherited, it is logical to expect that
individuals descending from a common ancestor would share the same values
for the same markers. Unfortunately for the genealogist (and fortunately
for the forensic scientist), the shuffling of maternal and paternal
chromosomes at every generation means that each individual carries an
assortment of DNA from all of his or her ancestors that guarantees his or
her uniqueness. In truth, this Diaspora of DNA over the generations does limit the potential of chromosomal DNA testing for genealogy but with one powerful exception. In human males, the members of 22 pairs of chromosomes look similar when viewed under a microscope. However, the twenty-third pair is mismatched, with two unlike chromosomes, called X and Y. In the cells of a female, both members of chromosome pair #23 are X chromosomes The X and Y chromosomes are called the sex chromosomes, because they differ between the sexes and because they carry the genes that determine the sex of the individual. The other 22 chromosomes are called autosomal chromosomes or simply autosomes. Whereas the DNA of autosomal chromosome pairs is shuffled and swapped repeatedly through the generations, the Y chromosome swaps less than five percent of its DNA with its partner X. Furthermore, these small exchangeable parts are limited to known locations on the chromosome (called pseudoautosomal regions:).
It is the Y chromosome that is of major
interest to the genealogist. A large number of STR markers
have been described for the Y chromosome that show great variability within populations but
virtually no variability between fathers and sons. Handed unchanged
from father to son, the Y chromosome markers become a signature or
fingerprint for the surname which is passed down in the same way in many
cultures.
As such, it is an ideal tool for verifying
paternal lineages
as male relatives who have
Y chromosome testing is particularly useful when a connection between different branches of a family, perhaps with the same or similar surnames, is suspected but cannot be proven from written records. |
|
The Path of Y Chromosome DNA Through Four Generations |
|
|
Male sharing Y chromosome via an
uninterrupted male-male link with a common ancestor |
Male with Y chromosome from outside the paternal line |
Females--have NO Y chromosome |
|
Barring a rare mutation or a non-paternity event (an adoption, a son taking his stepfather's name, or a "maternal indiscretion"), males represented by boxes filled with dark red will have identical values for all Y chromosome markers. Studies of nearly 5000 father son pairs showed only 14 STR mutations between the two generations with only one of those being a two step repeat and 13 being an increase of only one repeat of one marker. Kayser, Manfred, Lutz Roewer, Minttu Hedman, Lotte Henke, Jurgen Henke,
Silke Brauer, Carmen Kruger, Michael Krawczak, Marion Nagy, Tadeusz
Dobosz, Reinhard Szibor, Peter de Knijff, Mark Stoneking, and Antti
Sajantila, "Characteristics and frequency of germline mutations at
microsatellite ;oci from the human Y chromosome, as revealed by direct
observation in father/son pairs", Am. J. Hum. Genet. 66: 1580-1588,
2000
http://www.journals.uchicago.edu/AJHG/journal/issues/v66n5/991495/991495.html
|
|
|
