Contexo Home Project Home Page Site Contents Report Introduction Results Overview Lineage I Lineage II Lineage III Lineage IV Lineage V Lineage VI Ancient Irish Origins Andrew Dorsey? Harvey Kelley? Dorsey DNA Blog DNA Basics Support This Project Project Supporters Order a Kit

The Dorsey/Darsey/Darcy/Dawsey/Dossey/D'Arcy

Surname Project


 

 To Define and Verify Family Lines and Connections

Established 2002
This project is organized, administered, and paid for by family members
for the purpose of linking ourselves to the past.

DNA Project Report Introduction

 July 13, 2009

Introduction

The purpose of this project is to compare Y chromosome DNA of males with the surnames Dorsey, Darsey, D’Arcy, Dorcey, and Dossey and other variant spellings in order to identify and verify patrilineal lines and connections among families of those surnames worldwide.

The Dorsey Project currently has results for 81 project members.  This report includes results as of July 13, 2009.  We are fortunate to have well documented members from several Dorsey/Darsey/Darcy/Dawsey/Dossey/D'Arcy lines that have been the subjects of much interest, discussion, and argument by genealogists both past and present—the line of the American Immigrant Edward Darcy/Dorsey, the line of Norman D’Areci who is said to have accompanied William the Conqueror to England in 1066, and the line of the Irish D’Arcys of Kiltullagh are all represented along with several other newly identified groups.

Problems Addressed by this Study

General Objectives

The initial objective of this study was to determine whether any or all of the Dorsey (and variant spellings) families of the American South share a common ancestor within a genealogically significant timeframe.  Of particular interest to some was whether they were descendants of the Immigrant Edward Darcy/Dorsey whose ancestors had wandered away and lost track of their roots.  Consequently, one early and continuing focus was on recruiting proven descendants of each of Edward Darcy/Dorsey’s three sons in order to establish a core DNA signature that represents his line.   

Based on some associations in the public record and similar naming patterns, a group of Dorseys with roots in Western North Carolina believed they were connected to each other and that their common ancestor was Andrew Dorsey who moved from Baltimore County, MD to Rowan County, NC where he died in 1777.   They had wrung as much as they could from the scant records that detailed the events of the late 1700’s in that area but could not decipher the relationships they implied.  Nor could they determine whether their Maryland roots indicated descent from Edward Darcy/Dorsey.

A third group was bound by early roots in the Mid-Atlantic colonies and a common tendency to use the variant spelling Dossey.

A few other Dorsey/Darsey/Darcy/Dawsey/Dossey/D'Arcy’s from the US, Ireland and Australia had hit an impasse in the search for their ancestors and hoped for fortuitous matches that could point their research in the right direction.

As the study grew, our membership expanded to include representatives of a number of well-documented American and Irish Dorsey/D’Arcy/Darsey lines, making it possible to address several specific questions of long standing academic interest.  This project is ongoing and we are actively recruiting new members.

Do the lines of American Dorseys with roots in colonial Maryland share a common ancestor?

In addition to records placing the Immigrant Edward Darcy/Dorsey in mid-seventeenth century Anne Arundel County, Maryland,1 Nannie Ball Nimmo has reported records of a Ralph Dosey (Dasey/Dosse) in Calvert County by 1660 and in Talbot County in 1669, a James Dorsey in Maryland by 1668 and a John Dossey in Dorchester County in 1674.2 That these three were related is evidenced by their designation as “kinsmen” in the will of Richard Preston made in 1669.3 (The name is spelled both Dorsey and Dossey in the will.)  Ms Nimmo also presented a review of the records that document the descendants of these three men in Maryland.  However, many records of this area have been lost and the picture of these families is not as detailed as that of the line of Edward Darcy/Dorsey.  Their relationship with Edward Darcy/Dorsey is unclear as well.

Reports that these Dorseys were related to Edward Darcy/Dorsey have propagated throughout the genealogical literature, though they appear to be based on a conjecture that first appeared in writing over 200 years later.  Hester Dorsey Richardson, wrote in 1913 in Side-Lights of Maryland History,

There were two distinct branches of Darcys in Colonial Maryland, not in any way connected so far as the records show, but between which traditions of relationship exist in both branches.4

No other information has since been found that confirms or identifies the basis of these traditions. (Ms Richardson herself was a descendant of John Dossey of Dorchester County.)

Was the Immigrant Edward Darcy/Dorsey a direct line male descendant of Norman d’Areci?

The ancestry of the American Immigrant Edward Darcy/Dorsey has been the subject of much interest, research and debate.  In spite of the efforts of a number of eminent genealogists, no documents have emerged that name his parents or his whereabouts before he was recorded in Lower Norfolk County Virginia in the early 1640’s and then in Maryland by 1650.5  There has, however, been no lack of theory and conjecture on this topic.  The most popular claims make him a descendant of the Darcys of Hornby Castle Yorkshire, variously the son of Conyers D’Arcy, the 7th Lord Darcy de Knayth or his father or brother, both named Thomas.6,7,8,9,10

The 1st Lord (Baron) Darcy of Knayth was a ninth generation descendant of Norman De Areci, reportedly a companion of William the Conqueror.11  His line of descent was, according to Burke’s Peerage, 8John Darcy of Knayth (7Roger/6Philip/5Norman/4Thomas/3Thomas/2Robert/1Norman).12  8John Darcy 1st Baron De Knayth first married Emmeline, the daughter and heir of Walter Heron.  A son of that marriage, 9John Darcy, 2nd Lord of Knayth, became the ancestor of a number of well-documented English Darcy lines including the Darcys of Hornby Castle Yorkshire.13  Unfortunately, in spite of extended search efforts on the part of many genealogists including the British College of Heralds, there are no known living, documented male line descendants of this English line of 9John Darcy, 2nd Lord of Knayth, the hereditary title being now held by a female descendant.

The 1st Baron 8John Darcy of Knayth governed Ireland as Justiciary for many years.  In 1329, he married a second time to Joan de Brugh the daughter of Richard de Brugh, Earl of Ulster. A son 9William from that marriage, paternal half brother of the 2nd Baron 9John Darcy Knayth, was the ancestor of 12William D’Arcy of Platten, County Meath(11John/10John/9William/8John/7Roger/6Philip/5Norman/
4Thomas/3Thomas/2Robert/1Norman d’Areci),14  ancestor of two of our project members. We are fortunate to have these two well-documented descendants of Sir William D’Arcy of Platten in the Dorsey DNA Project.

Are the Irish D’Arcy’s of Kiltullagh descendants of the Anglo/Norman D’Arcy’s or the more ancient O’Dorchaidhe Clan or yet another unidentified line?

The D’Arcy’s of Galway were one of the families who made up the fourteen "Tribes of Galway." These families dominated the political, commercial, and social life of the Irish city of Galway from the 1400’s to the 1700’s.  The Galway family is descended from James Riveagh D'Arcy, who served as appointed Vice-President of the Province of Connaught.  He also served as Mayor of Galway (1602-1603).  James Riveagh D’Arcy died in 1603, leaving seven sons and one daughter.15  The D’Arcys of Kiltullagh descend from James Riveagh D’Arcy as do other prominent D’Arcy lines, the D’Arcy’s of Newforest, in the County of Galway and the D’Arcy’s of Clifton. 

There is much disagreement over the origins of James Riveagh D’Arcy.16  Burke’s Genealogical and Heraldic History of the Landed Gentry Including American Families with British Ancestry attaches James Riveagh D’Arcy to the Anglo-Norman D’Arcys as a son of Nicholas D’Arcy, brother of John D’Arcy de Knayth.17  However, Burke’s Landed Gentry of Ireland, published in 1958, notes that

 

. . . although according to a pedigree recorded at Ulster’s Office in 1770, James D’Arcy of Kiltullagh was descended from the Anglo-Norman family of D’Arcy, the Irish genealogist MacFerbis maintained this James D’Arcy descended from Walter Riabbach O’Dorchaidhe, the first man of the family who came to Galway.18 

John O’Hart presents an impressive pedigree for this O’Dorchaidhe line back to Fiachra, an elder brother of Niall of the Nine Hostages, the 126th Monarch of Ireland.19,20  Edward MacLysaght in his often quoted but rarely cited section on the O’Dorchaidhe clan in Irish Families, Their Names, Arms, and Origins, says

. . . the Darcys of Munster and Connacht (with very few exceptions) were of native Irish stock and their name is a corruption of the Gaelic O Dorchaidhe which was first anglicized as O’Dorcey.  There were two minor septs so called:  one in County Mayo was located around Partry near Lough Mask; the other in east Galway was a branch of a County Leitrim chieftain in the years 1384 and 1403.  O’Donovan in his notes to the Four Masters under the date 1310 places the MacDarcy sept in the parish of Oughteragh, County Leitrim.21

MacLysaght goes on to claim:

. . . it has been proved by O’Donovan [a noted seventeenth century Irish historian] that the Darcys who became one of the Tribes of Galway were of true Gaelic stock, being descended from the O’Dorceys of Partry, Co. Mayo.22

Nevertheless, many of the D’Arcys who descend from James Riveagh D’Arcy claim descent from the Norman line, and pedigrees have been registered and arms have been granted on that premise.

All the Science You Need to Understand the Results

Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed from parent to offspring. The “partners” of 22 pairs are matched in size, shape, and function in both males and females.  In females, the 23rd pair, called the “X” chromosomes, is also matched.  However, in males, the 23rd pair of chromosomes is mismatched with one “X” chromosome (received from the mother) and one “Y” chromosome (received from the father). Whereas all of the other chromosomes are blended, shuffled and distributed randomly when sex cells (egg and sperm) are formed, the Y chromosome is always handed down virtually intact from father to son.  For this reason, all of the direct male descendants of one male will share identical or nearly identical Y chromosomes. 

Each chromosome, including the Y, is a long strand of DNA (with some “accessory” proteins).  The DNA molecule is a chain made of four different subunits which are conveniently referred to as A, T, G, and C. The order of the four subunits in about 30,000 segments of human DNA, called genes, codes for all of a person’s traits.  In between these coding sections (genes) are long stretches of DNA that serve no known function. Many segments of this so-called “junk” DNA contain short repeating patterns (motifs) of the subunits.  For example, the series TACTACTACTACTACTACTACTACTACTACTACTAC is a repeat of 12 sets of the pattern TAC.  These repeating patterns are called Short Tandem Repeats or STR’s.  The same patterns occur at the same locations in everyone’s chromosomes.  However, the number of sets (repeats) varies from person to person.  Since the Y chromosome is passed nearly unchanged from father to son, all descendants of the same man will share the same number of repeats at the same locations (loci) on their Y chromosomes. Taken together the repeat numbers for a set of Y chromosome loci is a biochemical signature for all the male-line descendants of a given male. That signature can be used to identify his descendants even if surnames are changed along the way. 

Only rarely does a mutation occur between a father and a son causing one (or rarely more) STR to gain or lose one (or rarely more) pattern set.23  Over many generations, changes accumulate.  These variations allow us to identify different lineages and provide evidence for genealogical relationships when fortuitous mutations define branching points in descendants of a common ancestor.  The locations for which repeats are counted are called markers.  Most markers on the Y chromosome are called DYS markers (though new markers with other designations are rapidly appearing on the scene).  Individual markers are designated by a number or a combination of a number and letter.  A list of the values (number of repeats) for all of one man’s markers is called his haplotype.

In addition to being characterized by its array of STR markers, Y chromosomal DNA, like the DNA of the other chromosomes, can also be characterized by a second kind of mutation which involves the substitution of one of the subunits for another.  These mutations are called Single Nucleotide Polymorphisms (SNP’s).  SNP mutations are rare.  In fact, they occur so rarely that they are considered unique events in human history—each one occurring only once in only one person.  A Y chromosome Haplogroup is defined as all the male line descendants of the one person in whom a specific Y chromosome SNP first appeared. They will, of course, all test positive for this mutation.  The Y Chromosome Consortium24 has defined 18 major haplogroups designated by the letters A through R.25  Subgroups are identified by additional SNP’s which have occurred later in individual lines. They have been given numeric names which follow the haplogroup name.  Additional branches are designated by lower case letters.  Family Tree DNA and other commercial laboratories also offer SNP testing for determination of some haplogroups and subhaplogrous.  A few Dorsey DNA Project participants have also been "SNP tested" for haplogroup assignment. However, it is usually possible to estimate a person’s haplogroup based on the pattern of his STR markers, eliminating the need for SNP testing.  Of great interest are current projects using data from SNP and STR analyses to map the paths of human migration out of Africa and through the rest of the world 26,27,28,29

For further, more in depth, information about the science of DNA and how it can be used as a tool for genealogical research see DNA Basics at http://www.contexo.info/DNABasics.

Hypotheses and Predictions

In addition to assessing the probabilities of common patrilineal lines among individuals of the Dorsey surname or its variants, this study examines three hypotheses that appear frequently in published histories and genealogies from a new perspective of biological inheritance:

1.  If male members of the Dorsey, Darsey, and Dossey families with known or suspected roots in Colonial Maryland share a recent patrilineal common ancestor, then their Y chromosome DNA will all match.

2.  If Edward Darcy/Dorsey was the son of either Conyers D’Arcy, the 7th Lord Darcy de Knayth or his father, brother or other patrilineal descendant of Sir Norman d’Areci, then Edward Darcy/Dorsey’s descendants’ Y chromosome DNA will match the Y chromosome DNA of registered descendants of William D’Arcy of Platten, who shared a common ancestor, the 1st Baron 8John Darcy of Knayth, with Conyers D’Arcy the 7th Lord Darcy de Knayth and who was a direct line male descendant of Sir Norman d’Areci.

3.  If James Riveagh D’Arcy was a descendant of the brother of John D’Arcy de Knayth or of someone of the same patrilineal line, then his descendants’ Y chromosome DNA will match the Y chromosome DNA of the proven descendants of Sir William of Platten.

Experimental Procedure

Lab work and reports for this project were coordinated by Family Tree DNA (www.familytreedna.com).  Using a kit and directions supplied by Family Tree DNA30, each participant provided two samples of cheek cells collected at least eight hours apart.  The scrapings were sealed in small vials of preservative and returned by mail to Family Tree DNA.

For this experiment, repeating patterns at 25-37 different locations (markers) on the Y chromosome were compared at the laboratory of Dr. Michael Hammer in the University of Arizona using methods previously reported by Redd et al31 and Butler et al.32 The number of repeats at each location was determined for each participant and genetic distances among participants calculated.  An estimated haplogroup has also been reported by the lab for all project participants.  In addition a number of participants have had further SNP testing to confirm their Haplogroup assignment.

Dorsey DNA Project Results and Discussion

As the Dorsey DNA Project has grown in size, the results and accompanying discussion have also increased in size and complexity. For that reason, the results and discussion sections are now presented in several different formats to suit individual readers' interest and needs.

Web Based Results Options

Click on blue links.
An html Results Chart with a short narrative and summary of results 

This page should work with Internet Explorer,  Foxfire, and Safari though there may some problems with lower screen resolutions.  A lower resolution friendly version may be coming soon
.

Results and detailed discussions for some individual lineages are also presented separately

Lineage I

Includes the line of the Immigrant Edward Darcy/Dorsey and several participants with proven Irish roots.

Lineage II

Includes several American families who use the variant spelling Dossey

Lineage III

The line of Andrew Dorsey who moved from Baltimore County, MD to Rowan County NC in 1766

Lineage IV

Two members with roots in Tipperary Ireland

Lineage V

The Anglo/Norman d'Arcys


Results Options to Download to Your Own Computer
Click on blue links or icons

DNA Project Report
  745 KB

Dorsey/Darsey/Darcy/ D'Arcy/Dossey/Dawsey DNA Project Report
Monday, July 13, 2009
A printer friendly PDF version of the entire project report.  


Microsoft Excel Help

Dorsey DNA Project Data
96 KB
An Excel Spreadsheet of Project Data Formatted like the HTML Results Page
To view in a web browser, click on the Excel icon. To save to your hard drive, right click on Excel icon and choose "Save As"


Microsoft Excel HelpDorsey DNA Project Data minimal formatting

83 KB

An Excel Spreedsheet of Project Data with minimal formatting

(for data miners)

To view in a web browser, click on the Excel icon. To save to your hard drive, right click on Excel icon and choose "Save As"


Irish Origins of the Dorsey/Darcy/D'Arcy Surname
56 KB
Some speculations about the origins of Edward Darcy/Dorsey and the D’Arcys of Galway in light of a few bits and pieces from mythology, history, genealogy and science.


A free copy of Adobe Acrobat reader


Endnotes


1. Maxwell J Dorsey, Jean Muir Dorsey, and Nannie Ball Nimmo, The Dorsey Family : descendants of Edward Darcy-Dorsey of Virginia and Maryland for five generations and allied families  (Urbana, Ill.?: unknown, c1947), 288 pgs. The authors offer a plethora of citations from colonial Virginia and Maryland records of Edward Darcy-Dorsey and the first five generations of his descendants.

2. Nannie Ball Nimmo, “The Dorsey (Dossey) Family of Calvert County,” Maryland Marriages and Genealogies, 1634-1820, Maryland Genealogies, 2 volumes, (Baltimore:  Genealogical Publishing Co., 1975) 1: 410-413.

3. Nimmo, “The Dorsey (Dossey) Family of Calvert County”, 410.

4. Hester Dorsey Richardson, Side-Lights of Maryland History with Sketches of Early Maryland Families, (Baltimore, Genealogical Publishing Co., In., 1913) 86-87.

5. Dorsey,  Dorsey, and  Nimmo, The Dorsey Family : descendants of Edward Darcy-Dorsey of Virginia and Maryland for five generations and allied families, 1-2.

6. Caroline Kemper Bulkley, “Identity of Edward Dorsey I, A New Approach to an Old Problem”, Maryland Genealogies, Consolidation of Articles from the Maryland Historical Magazine, 2 volumes, (Baltimore:  Genealogical Publishing Co., Inc., 1980) 1: 377–405 originally published in Maryland Historical Magazine, 1938.

7. Nellie Owings Chaney, “Edward Dorsey – A Review and Question”, Maryland Genealogical Society Bulletin 38, No. 2 (Spring 1997): 210-214.

8. Harry Wright Newman, To Maryland from Overseas, (Annapolis:  H.W. Newman, 1982).

9. Lois Collette Dorsey Bennington, Grandparents are Great, The History and Genealogy of the Darcy-Dorsey Family, Vol I, (?:  Privately printed, 1982) 2.

10. Charles Frances Stein, A History of Calvert County Maryland, Bicentennial Revised Edition, (Baltimore: C.F. Stein, 1960), 467-468.

11. Bob Sewell, “List of Those Accompanying William the Conqueror on His Invasions of England 1066” http://www3.sympatico.ca/robert.sewell/dives.html This list is taken from the plaque in the church at Dives-sur-Mer, Normandy, France, where William the Conqueror and his knights said mass before setting sail to invade England in 1066. It lists all the knights who took part in the invasion. Unfortunately, it was compiled several hundred years after the actual invasion so may not be a true account.

12. Charles Moseley, Burke’s Peerage & Baronetage, 1: 760-761.

13. Moseley, Burke’s Peerage & Baronetage, 1: 760-761.

14. Sir Bernard Burke, Burke’s Genealogical and Heraldic History of the Landed Gentry of Ireland, 4th Ed., L. G. Pine editor, (London:  Burke’s Peerage, Ltd., 1958.) 211.

15. Ancestry.com.  Burke's Commoners of Great Britain and Ireland databasemonline Provo, UT; Ancestry.com 2002.  Original data; Burke, Bernard. A genealogical and heraldic history of the landed gentry: or, Commoners of Great Britain and Ireland enjoying territorial possessions or high official rank; but uninvested with heritable honours.  London: Colburn, 1837-38.

16. Ancestry.com Burke’s Commoners of Great Britain and Ireland, September 24, 2004.

17. Sir John Bernard Burke, Burke's genealogical and heraldic history of the landed gentry: including American families with British ancestry, founded 1837 by Sir Bernard Burke, illustrated with heraldic colour plates, 3 volumes (London:  Burke’s peerage, 1939) 1: 560 accessed September 24, 2004.

18. Burke, Burke’s Genealogical and Heraldic History of the Landed Gentry of Ireland  211.

19. John O’Hart, Irish Pedigrees or The Origin and Stem of The Irish Nations, 5th edition,  2 volumes (1892: reprint Baltimore:  Genealogical Publishing Co., Inc., 1989) 1:  401-402.

21. Edward MacLysaght, Irish Families Their Names, Arms and Origins, (Dublin:  Hodges, Figgis, & Co. Ltd, 1957) 111.

22. MacLysaght, Irish Familie, Their Names, Arms, and Origins, 111.

23. Manfred Kayser, Lutz Roewer, Minttu Hedman, Lotte Henke, Jurgen Henke, Silke Brauer, Carmer Kruger, Michael Krawczak, Marion Nagy, Tadeusz Dobosz, Reihnhard Szibor, Peter de Knijff, Mark Stone,king, and Antti Sajantila, “Characteristics and Frequency of Germline Mutations at Microsatellite Loci from the Human Y Chromosome, as Revealed by Direct Observation in Father/Son Pairs”, American Journal of Human Genetics (2000) 66: 1580-1588.

24. The Y Chromosome Contortium, http://ycc.biosci.arizona.edu/. 

25. The Y Chromosome Consortium, “A Nomenclature System for the Tree of Human Y Chromosomal Binary Haplogroups,” Genome Res., Feb 2002; 12: 339 - 348 (Full text available at http://www.familytreedna.com/pdf/YCC%2020021.pdf.)

26. DNA Heritage, Masterclass, SNPS and Haplogroups, 2004, http://www.dnaheritage.com/masterclass2.asp .

27. Family Tree DNA, Tutorial, Y DNA Haplogroups, 2001-2004 online at: http://www.familytreedna.com/tutorialA.html.

28. For a long, comprehensive list of books on this subject at every level, please see http://www.familytreedna.com/books.html.

29.The National Geographic Society, “The National Genographic Project, A Landmark Study of the Human Journey”, 2005-2006, online:  https://www3.nationalgeographic.com/genographic/index.html.

30. Family Tree DNA Test Kit, Family Tree DNA –Genealogy by Genetics, 1919 North Loop West, Suite 110, Houston, Texas 77008, USA online: http://www.familytreedna.com/kit.html. 

31. Alan J. Redd, Al B. Agellon, Veronica A. Kearney, Veronica A. Contreras, Tatiana Karafet, Hwayong Park, Peter de Knijff, John M. Butler, Michael F. Hammer, “Forensic value of 14 novel STRs on the human Y chromosome,” Forensic Science International 3460 (2002) 1–15.  (Available online http://www.ftdna.com/pdf/Redd-FSI-02.pdf.)

32. John M Butler, Richard Schoske, Peter M. Vallone, Margaret C. Kline, Alan J. Redd,  and Michael F. Hammer, “A novel multiplex for simultaneous amplification of 20 Y chromosome STR markers,” Forensic Science International 129 (2002) 10-24. (http://www.ftdna.com/pdf/Butler, et al2002.pdf.)

 

This page was last updated
Monday, July 13, 2009

Hit Counter